NEET 2023
Physics
 
Question 1: The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:
Options:
(a)
  • 1
V
  • 1
  • V 2
Answer: (b)
Solution: Minimum cut of wavelength l µ 1
V
Question 2: A carnot engine has an efficiency of 50% when its source is at a temperature
327°C . The temperature of the sink is:
Options:
  • 27°C
  • 15°C
(c) 100°C
(d) 200°C
Answer: (a)
 
Solution: h = 1-
 
1 = 1- TSINK
2          600
TSINK TSOURCE
 
TSINK
= 1- 1 = 1
 
600          2     2
TSINK = 300K or 27°C
 
 
Question 3: A bullet is fired from a gun at the speed of 280ms-1 in the direction 30° above
the horizontal. The maximum height attained by the bullet is (g = 9.8ms-2 ,sin 30° = 05):
Options:
(a) 2800 m
(b) 2000 m
(c) 1000 m
(d) 3000 m
Answer: (c)
 
Solution:
U 2 sin2 q
H =
2g
 
 
= 280´ 280sin2 30
2´ 9.8
= 280´ 280´1 = 1000 m
2´9.8´ 4
 
 
 
Question 4: In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1mF
resistance R is 100W. The frequency at which resonance occurs is:
Options:
  • 9 rad/s
  • 9 kHz
  • 59 rad/s
  • 59 kHz
Answer: (d)
and
 
 
Solution: f =
 
= 1                  1
2p    10 ´10-3 ´1´10-6
= 1       1
 
2p
= 104
2p
10-8
 
= p ´104
2p 2
p
=     ´103
2
= 3.14 ´103
2
=1.59´103
=1.59kHz
 
  
Question 5: Given below are two statements:
Statement I: Photovoltaic devices can convert optical radiation into electricity.
Statement II: Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below:
Options:
  • Both Statement 1 and Statement II arc
  • Both Statement I and Statement II are
  • Statement I is correct but Statement II is incorrect
  • Statement 1 is incorrect but Statement II is
Answer: (a)
Solution: BOTH STATEMENTS ARE CORRECT
 
 
 
 
Question 6: Light travels a distance x in time
t1 in air and 10x in time
t2 in another denser
 
medium. What is the critical angle for this medium?
Options:
 
  

(a) sin-1 æ t2 ö
ç t ÷
è 1 ø
 
  

(b) sin-1 æ 10t2 ö
ç        ÷
è t1     ø
 
  
è
 
2 ø
 
(c) sin–1 æ t1  ö
ç 10t ÷
 
  
t
 
(d) sin-1 æ 10t1 ö
ç        ÷
è    2    ø
Answer: (d)
Solution: Using snell’s law
m1v1 = m2v2
an        medium
 
ò
 
x = m
t        2
10x
 
t
 
1                        2
 
m2 =
t2
10t1
 
sin C = 1
m2
 
= 10t1
t2
=   1
t2
10t1
 
C = sin–1 10t1
t2
 
 
Question 7: In hydrogen spectrum, the shortest wavelength in the Balmer series is l . The shortest wavelength in the Bracket series is:
Options:
  • 2l
  • 4l
  • 9l
(d) 16l
Answer: (b)
 
Solution:
1 = R é 1
 
– 1 ù
 
 
l        êh 2        h 2 ú
ë 2             1 û
For Balmer
      
      

1 = R é 1 – 1 ù
l        êë 22                ¥ úû
 
 
1 = R
               
l     4
l = 4
R
For Brackett
 
1 = R é 1
l¢        êë 42
= R
1 ù
–
 
92 úû
 
16
l¢ = 16 = 16 = 4l
R      4
l
Question 8: If the galvanometer G does not show any deflection in the circuit shown, the value
of R is given by:
 
Options:
(a) 200W
(b) 50W
(c) 100W
(d) 400W
Answer: (c)
Solution: l =  8
 
 
 
= 1 amp
 
 
V across R
V = LR
400     50
 
2 = 1 ´ R
50
R =100W
 
Question 9: The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly: (Surface tension of soap solutions = 0.03 N m-1 )
Options:
(a) 30.16´10-4 J (b) 5.06´10-4 J (c) 3.01´10-4 J (d) 50.1´10-4 J
 
 
 
Answer: (c)
Solution: Surface energy of bubble = 2[T.Area]
= 0.03´ 4pr2 ´ 2
= 0.03´ 4p ´(2´10–2 )2 ´ 2
= 0.03´16p ´10-4 ´ 2
=16p ´10-4 ´0.03´ 2
=16p ´10-4 ´0.03´ 2
= 48p ´10-6 ´ 2
=150.72´10-6 ´ 2
= 301.44´10-6
= 3.01´10-4 J
Question 10: The magnetic energy stored in an inductor of inductance 4mH
of 2A is:
Options:
  • 4mJ
  • 4mJ
  • 8mJ
  • 8mJ
Answer: (d)
Solution: 1J = 1 Li2
2
= 1 ´ 4´10–6 ´(2)2 2
= 8´10-6 J
= 8mJ
 
 
 
 
 
 
 
 
 
 
 
 
carrying a current
 
 
Question 11: A 12V, 60W lamp is connected to secondary of step down transformer, whose
primary is connected to ac mains of 220V. Assuming the transformer to be ideal, what is the current in the primary winding?
Options:
(a) 0.27 A
  • 7 A
  • 7 A
(d) 0.37 A
Answer: (a)
Solution: Since the transformer is ideal,
Pinput = Poutput
220´ Iinput = 60
 
Iinpu
= 60
220
= 0.27 A
 
 
Question 12: An electric dipole is placed at an angle of 30° with an electric field of intensity 2´105 NC-1. It experiences a torque equal to 4Nm. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
Options:
 
 
  • 8 mC
  • 6 mC
  • 4 mC
  • 2 mC
Answer: (d)
Solution: t = rE sinq
4 = (ql ) E sin 30°
4 = q ´  2  ´ 2´105 ´ 1
100                 2
q = 2 ´10–3C = 2mC
 
Question 13: A vehicle travels half the distance with speed v and the remaining distance with speed 2v . Its average speed is
Options:
  • v
3
  • 2v
3
  • 4v
3
  • 3v
4
Answer: (c) Solution:
Question 14: Let a wire be suspended from the ceiling (rigid support) and stretched by a weight
W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is:
Options:
  • 2W
A
  • W
A
  • W
2A
(d)  Zero Answer: (b) Solution:
 
 
 
  
 
Options:
  • the number of flux lines entering the surface must be equal to the number of flux lines leaving
  • the magnitude of electric field on the surface is constant
  • all the charges must necessarily be inside the
  • the electric field inside the surface is necessarily
Answer: (a) Solution:
 
ÞNet flux through the closed surface is O.
\ No of field lines entering = No. of field lines leaving
Question 16: The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14
eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?
Options:
  • Cs only
  • Both Na and K
  • K only
  • Na only
Answer: (a)
Solution: For photoelectric effect to take place,
EIncident radiations > Work functions.
 
Question 17: The temperature of gas is -50°C . To what temperature the gas should be heated so that the rms speed is increased by 3 times?
Options:
(a) 669°C
(b) 3295°C
(c) 3097 K
(d) 223 K
Answer: (b)
 
 
Solution: Initial temperature = -50°C = 223K
 
Initial rms speed =
 
Now, the rms speed should be increased by 3 times.
\Final Jrms = J + 3J = 4[Jrmsinitial]
\             = 4
T2 = 3568K
= 3295°C
 
Question 18: The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is:
Options:
(a) 1 : 2
(b) 2 : 1
(c) 1 : 3
(d) 3 : 1
Answer: (b)
Solution: Fundamental frequency of open pipe = v
2L
Fundamental frequency of closed pipe = v
4L
 
Ratio:
v ´ 1
2L      v
4L
= 2 :1
 
 
Question 19: Resistance of a carbon resistor determined from colour codes is (22000 ± 5%)W
. The colour of third band must be:
Options:
  • Red
  • Green
  • Orange
  • Yellow
Answer: (c)
Solution: (22000 ± 5%)W
(22´103  ± 5%)W  First digit: 2 ® Red Second digit: 2 ® Red
Multiplier: 103 ®Orange Tolerance: 5% ® Gold
 
Question 20: For Young’s double slit experiment. two statements are given below: Statement I: If screen is moved away from the plane of slits, angular separation of the gas remains constant.
 
 
Statement II: If the monochromatic source is placed by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose answer from the options given below:
Options:
  • Both Statement I and Statement II are
  • Both Statement I and Statement II are false
  • Statement I is true but Statement II is false
  • Statement I is false but Statement II is
Answer: (b)
Solution: Both Statement I and Statement II are false
 
Angular separation between the fringes
= Fringe Width = b =
D              D
 
\ Moving the screen away, i.e. increasing D, will not affect the angular separation. Also, on increasing wavelength, angular separation increases.
 
 
Question 21: A metal wire has mass (0.4 ± 0.002) g,
radius (0.3 ± 0.001) mm
and length
 
(5 ± 0.02) cm . The maximum possible percentage error in the measurement of density will nearly be:
Options:
(a) 1.2%
(b) 1.3%
(c) 1.6%
(d) 1.4%
Answer: (c)
Solution: m = (0.4 ± 0.002) g
r = (0.3 ± 0.001) mm
l = (5 ± 0.02)cm
 
d = m =
m Þ Dd
= Dm + 2Dr + Dl
              
 
V     nr2l        d
m        r        l
 
= 0.002 + 2´ 0.001 + 0.02
0.4             0.3         5
= 0.02 + 0.02 + 0.02
4         3         5
 
  

= 0.02æ 15 + 20 +12 ö
ç        60        ÷
è                    ø
= 0.02´ 47
60
= 0.02´0.783
= 0.0156
Dd ´100 = 1.56% » 1.6%
d
 
Question 22: The equivalent capacitance of the system shown in the following circuit is:
 
 
 
  
Options:
  • 2mF
  • 3mF
  • 6mF
(d)   9mF Answer: (a) Solution:
 
Ceq
= 3´ 6 = 18 = 2mF
3 + 6     9
 
 
Question 23: Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant):
Options:
  • – 8Gm
R
  • -12Gm
R
  • -16Gm
R
 
 
  • -20Gm
R
Answer: (c) Solution:
 
  
Let gravitational field at point P is zero. Which is situated at distance x from mass m.
\ Gm = G (9m)
x2            ( R – x)2
Square root both sides
1 =     3
              
x   R – x R – x = 3x R = 4x
x = R
4
Gravitational potential at point P
= – Gm – G (9m)
x      ( R – x)
é                  ù
    
    

= –Gm ê 1 +     9    ú
ê R            R ú
ê        R –     ú
ë 4            4 û
é              ù
    
    

= –Gm ê 1 + 9 ú
ê R     3R ú
ê              ú
ë 4       4  û
    
    

= – Gm é4 + 36 ù
R êë      3 úû
= – Gm [4 +12]
R
= – 16Gm
R
 
Question 24: The venturi-meter works on:
Options:
  • Huygens’s principle
  • Bernoulli’s principle
  • The principle of parallel axes
  • The principle of perpendicular axes
 
 
Answer: (b)
Solution: (Direct theory question)
Venturi meter works on Bernoulli’s principle
 
Question 25: The half life of a radioactive substance is 20 minutes. In how much time, the
æ 1 öth
 
16
 
activity of substance drops to ç     ÷
è     ø
of its initial value?
 
Options:
  • 20 minutes
  • 40 minutes
  • 60 minutes
  • 80 minutes Answer: (d) Solution: Given
r
 
2
 
T = 20 min (T )
N = 1
No          16
We know
 
N     æ 1 ön            1
æ 1 ön
æ 1 ö4
 
N = ç 2 ÷
= 16 Þ ç 2 ÷
= ç 2 ÷
 
o     è    ø                è    ø      è    ø
n = 4
 
Where n is no. of half lines So, Now, time t = nT = 4´ 20 = 80min
 
Question 26: A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning as:
Options:
  • Along Eastward
  • Along Northward
  • Along North-East
  • Along South-West
Answer: (c)
Solution: Change in momentum direction will give direction of force.
 
 
 
 
 
 
 
 
 
 
As first player moves towards south So, direction – ˆj
pi =- piˆj
 
 
Secondly turns towards East So, direction (+iˆ)
pf + pf (iˆ)
Dp = pf – pi = pf (iˆ)- (- pi ˆj )
= pf iˆ + pi ˆj
= piˆ + pˆj
= p (iˆ + ˆj )
This is North East Direction
Also, force direction while turning
 
As the turns with same speed
pf   = pi   = p
 
 
Question 27: The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are:
Options:
  • Instrumental errors
  • Personal errors
  • Least count errors
  • Random errors
Answer: (d)
Solution: Direct theorem question
The errors in measurement which rise due to unpredictable fluctuations in temperature and voltage supply are random errors.
Question 28: The angular acceleration of a body, moving along the circumference of a circle,
is:
Options:
  • Along the radius, away from centre
  • Along the radius towards the centre
  • Along the tangent to tis position
  • Along the axis of rotation
Answer: (d)
Solution: Direct theory question
Angular acceleration of a body moving along the circumference of a circle is along the axis of rotation.
 
Question 29: A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
Options:
  • A centre-tapped transformer
  • p-n junction didoes
  • Capacitor
  • Load resistance
Answer: (c)
Solution: Direct theory question
Capacitor is used to remove the ac ripple from rectified output.
 
 
 
Question 30: The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is:
Options:
(a) 3 : 5
(b) 5 : 3
(c) 2 : 5
(d) 5 : 2
 
  

Answer: None of the options are correct Solution:
Question 31: The magnitude and direction of the current in the following circuit is
Options:
  • 2 A from B to A through E
  • 5 A from A to B through E
  • 5 A from A to B through E
9
  • 5 A from B to A through E
Answer: (b)
Solution: Magnitude and direction of current
 
 
 
Applying KVL
Let’s take current is moving clock wise
-2I – 7I – I +10 – 5 = 0
-10I + 5 = 0
+10I = +5
I = 1 = 0.5A
2
 
  

F (+ve) so from A ® B through ‘E’.
Question 32: An ac source is connected to a capacitor C. Due to decrease in its operating
frequency:
Options:
  • Capacitive reactance decreases
  • Displacement current increases
  • Displacement current decreases
  • Capacitive reactance remains constant
Answer: (c)
 
Solution:
I = E XC
 
I =  E
1
 
wC
= E.wC
 
I = E.2p f .C
So, if frequency decreases then displacement current decreases.
So, as conduction current decreases ® Displacement current also decreases.
Question 33: The net magnetic flux through any closed surface is:
Options:
  • Zero
  • Positive
  • Infinity
  • Negative
Answer: (a)
Solution: Magnetic flux through a closed surface is zero
As no.of lines entering should be equal to the no. of lines leaving
ò B.dA = 0
 
Question 34: In a plane electromagnetic wave travelling in free space, the electric field
component oscillates sinusoidally at a frequency of 2.0´1010 Hz and amplitude 48Vm-1 . Then
 
the amplitude of oscillating magnetic field is: (Speed of light in free space
= 3´108 ms-1 )
 
 
Options:
(a) 1.6´10-9T (b) 1.6´10-8T (c) 1.6´10-7T (d) 1.6´10-6T
Answer: (c)
 
Solution:
EO = BoC
EO = 48v / m
 
48
3´108
= Bo
 
Bo =16´10–8
=1.6´10-7T
Question 35: The potential energy of along spring when stretched by 2 cm is U. if the spring
is stretched by 8 cm, potential energy stored in it will be:
Options:
  • 2U
  • 4U
  • 8U
  • 16U
Answer: (d)
Solution: Potential energy stored in spring = 1 kx2
2
 
  

1 kx2
v1 = 2    1
             
v2           1 kx2
2    2
U       x
 
=
 
2
     1           1  
U       x
 
2
2              2
 
 U1 =
U2
(2)2
(8)2
 
U = 64´U = 16U
 
  

2                U
Question 36: A bullet from a gun is fired on a rectangular wooden block with velocity u. When
bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes
u . Then it further penetrates into the block in the same direction before coming to rest exactly
3
at the other end of the block. The total length of the block is:
Options:
  • 27 cm
  • 24 cm
  • 28 cm
  • 30 cm
Answer: (a)
 
 
Solution: Condition 1: v = u
f          3
S = (24)
vi = u
Using v2 = u2 + 2as
æ u ö2                    2
 
3
 
ç    ÷
è    ø
u2  =
 
= (u )
 
2
  • 2as
 
u + 2.a.24
g
 
– 8u2 =
g
u
 
2
a =-
48.a
 
54
Condition 2:
 
v f = 0
u = 4
i          3
2
 
æ 4 ö2
 
 
æ    u2 ö
 
(0)
= ç 3 ÷
+ 2ç – 54 ÷´ s
 
è    ø        è        ø
– u2 = -2 u2 ´
    
    
s
g          54
s = 3m
So total length 24 + 3 = 27m
Question 37: A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity 3p represents:
Gd
Options:
  • T
  • T 2
  • T 3
  • (d)
Answer: (b)
 
  

Solution: Time period of satellite
 
T = 2p
Density = d
Mass = density ´ volume
 
 
= d ´ 4 p R3
3
T = 2p
 
 
 
T = 2p
 
T 2 = 4p 2.
T 2 = 3p
Gd
 
3
 
4p Gd


Question 38: The radius of inner most orbit of hydrogen atom is radius of third allowed orbit of hydrogen atom?
Options:
(a) 0.53A
(b) 1.06 A
(c) 1.59 A
(d) 4.77 A
Answer: (d)
1
 
Solution: n = 3, n = 1, r = 5.3´10–11
5.3´10-11m . What is the
 
1
 
n
 
r = rn2
r  = r (3)2
3           1
= 5.3´10-11 ´9
= 4.77´10-10
Question 39: The net impedance of circuit (as shown in figure) will be
Options:
(a) 10 2W
(b) 15W
(c) 5 5W
(d) 15W
 
 
Answer: (c)
 
Solution:
X   = 2p ´ 50´ 50 ´10–3
L                                        p
 
L
 
X = 5000´10-3 = 5W
 
XC =
1
 
100p ´ 1000 ´10-6
p
 
( XC = 10W)
R =10W
Z =
=
 
  
Question 40: The x-t graph of a particle performing simple harmonic motion is shown in the
figure. The acceleration of the particle at t = 2s is:
Options:
p 2             -2
  • ms
8
 
p
 
2
  • –
8
ms-2
 
  •  
2
p
 
ms-2
16
 
p
 
2
  • –
16
ms-2
 
Answer: (d)
Solution: x = Asin (wt + f )
t = 0, x = 0,f = 0
x = Asinwt
T = 2p
w
2p = 8 æw = p ö
w         ç        4 ÷
è           ø
x = sinwt as ( A = 1)
 
 
dx = (coswt ).w
dt
= -w2
 
w
 
d 2 x
dt2                          sin t
p 2            æ p         ö
 
è            ø
 
a = – 16 sin ç 4 k ´ 2 ÷
at t = 2
 
p 2
a =-
16
p 2
=-
16
sin æ p ö
ç 2 ÷
 
è    ø
 
 
Question 41: In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?
Options:
  • 40 cm
  • −40 cm
  • −100 cm
  • −50 cm Answer: (c) Solution:
        
        

1 = æ mR -1öæ 1 – 1 ö
 
f     ç m
÷ç R      R  ÷
 
è    S        øè  1         2 ø
 
 
        
        

1 = æ 1.6 -1öæ 1 – 1 ö
f      ç 1       ÷ç ¥    20 ÷
1     è           øè          ø
ç 20 ÷
 
1 = 0.6 æ -1 ö
f1             è      ø
1 = -0.3
f1        10
Since left side lense & right side lense are same
 
1 = 1
f3        f1
= 0.3
10
 
        
        

1 = æ 1.5 -1 öæ 1 –        1    ö
f      ç     1     ÷ç 20    (-20) ÷
2      è           øè               ø
    
    

1 = 0.5æ 2 ö
ç      ÷
20
 
f2              è      ø
1 = 0.5
f2       10
1 = 1 + 1 + 1
F      f1       f2       f3
= -0.3 + 0.5 + (-0.3)
10      10        10
= -0.6 + 0.5 10
= -0.1 10
1 =  -1
F     100
F = -100 cm
 
Question 42: An electric dipole is places as shown in the figure,
 
The electric potential (in 102 V) at point P due to the dipole is (Î0
permittivity of free space
 
and
1
4p Î0
= K ):
 
Options:
  •  
ç 8 ÷
 
  • æ3 öqK
è ø
  •  
ç 8 ÷
 
  • æ5 öqK
è ø
 
 
  •  
ç 5 ÷
 
  • æ8 öqK
è ø
  •  
ç 3 ÷
 
  • æ8 öqK
è ø
Answer: (a) Solution:
VD = Vq +V–q
=         Kq        +       K (–q)  
(5 – 3)´10-2        (5 + 3)´10-2
      
      

= Kq é 1 – 1 ù
10-2 êë 2     8 úû
 
  

= Kq ´102 é8 – 2 ù
êë 16 úû
= Kq é 6 ù ´102
êë16 úû
V = Kq é3ù´102
D             êë8 úû
 
Question 43: A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s-1. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s-2):
Options:
  • 56 m
  • 60 m
  • 64 m
(d)  68 m Answer: (c) Solution:
u = 4 m/s
a = -10 m/s2
S = –H t = 6
 
 
S = ut + 1 at 2
2
–H = 4 (4) + 1 (-10)(4)2
2
–H = 16 – 5´16
–H = 16 (1- 5)
H = 64 m
 
Question 44: Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is (g = 10 m s-2)
Options:
(a) 1.2 m s-2
(b) 150 m s-2
(c) 1.5 m s-2
(d) 50 m s-2 Answer: (c) Solution:
Observing body from car i.e., non inertial frame of reference From this frame, body is in equilibrium
 
N = mg
….(1)
 
ma = fc
ma = ms N
ma = ms (mg ) from a = ms g
a = 0.15´10
 
  

a = 1.5 m / g 2
 
Question 45: 10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is:
Options:
(a) 10
(b) 100
(c) 1
 
 
(d) 1000
Answer: (b) Solution:
 
  
 
Req = nR = 10xR
I  =      E      =  E
              
1     Req + r     10R
Req = R = R
n     100
I =      E      = E
              
2     Req + r      R
10
I = 10E
2         R
 
Now
 
  

10 E
 
I2 =      R
= 100
 
I1          E
10R
I2 = 100I1
n = 100
 
Question 46: For the following logic circuit, the truth table is:
 
 
 
Options:
 
A
B
Y
0
0
1
(a)
0
1
1
 
1
0
1
 
1
1
0
 
A
B
Y
 
0
0
0
(b)
0
1
1
 
1
0
1
 
1
A
1
B
1
Y
 
0
0
1
(c)
0
1
0
 
1
0
1
 
1
A
1
B
0
Y
 
0
0
0
(d)
0
1
1
 
1
0
1
 
1
1
1
Answer: (b) Solution:
Y = A × B
Y = A + B Y = A + B
It is effectively OR gate
\ Truth table
 
 
 
A
B
A + B
0
0
0
0
1
1
1
0
1
1
1
1
 
Question 47: A very long conducting wire is bent in a semi-circular shape from A to B as shown in figure. The magnetic field at point P for steady current configuration is given by:
Options:
 
(a)
 
(b)
m0i
4R
m0i
4R
pointed into the page
 
pointed away from the page
 
(c)
m0i é1- 2 ù
 
pointed away from the page
 
4R êë    p úû
 
(d)
m0i é1- 2 ù
 
pointed into the page
 
4R êë    p úû
Answer: (c)
 
  

Solution:
As per sign convention magnetic field by all three parts at point P Hence net electric field,
 
Ä
 
B = BI    + BII
  • BIII
 
Ä
 
B = –BI + BII – BIII
 
B = -m0I + m0
I (p ) – m0 I
 
4pr
4p r
4pr
 
      
      

B = m0 I é- 1 +1- 1 ù
4r êë p         p úû
 
 
    
    

B = m0 I é1- 2 ù
4r êë    p úû
As this answer is positive outward
 
 
Question 48: The resistance of platinum wire at 0°C temperature coefficient of resistance of the wire is: Options:
(a) 3´10-4 °C-1 (b) 3´10-3 °C-1 (c) 3´10-2 °C-1 (d) 3´10-1 °C-1 Answer: (c)
Solution:
R0 = 2W ® T0 = 0°C
R = 6.8W ®T = 80°C
R = R0 (1+ aDT )
R – R0 = R0aDT
a = R – R0
R0DT
a = 6.8 – 2
2 ´ 80
a = 4.8
160
is 2W and 6.8W at 80°C . The
 
a =     48 16 ´100
a = 3´10–2 °C
 
Question 49: A wire carrying a current I along the positive x-axis has length L. It is kept in a
 
magnetic field
Options:
  • 3 IL
B = (2iˆ + 3 ˆj – 4kˆ)T. The magnitude of the magnetic force acting on the wire is:
 
  • IL
  • 5 IL
  • IL
Answer: (c) Solution:
 
 
 
L = Liˆ
Force on conductor due to external magnetic field
F = I (I ´ B )
ë                             û
 
F = I éLiˆ´ (2iˆ + 3 ˆj – 4kˆ)ù
ë                                              û
 
F = I é2L ´ 0 + 3L (iˆ´ ˆj ) – 4L (iˆ´ kˆ)ù
ë                      û
 
F = I é36kˆ – 4L (- ˆj )ù
ë            û
 
F = IL é4 ˆj + 3kˆù
= IL F = 5IL
 
Question 50: Two thin lenses are of same focal lengths (f ), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be:
Options:
  • Zero
  • f
4
  • f
2
  • Infinite Answer: (d) Solution:
For equivalent focal length
 
 
1 = 1 + 1
F      f1       f2
      
      

1 = 1 +    1
F      f     (- f )
1 = 0
F
F = 1
0
F =¥
 
 
 
 
Question 51: Select the correct statements from the following:
  1. Atoms of all elements are composed of two fundamental
  2. The mass of the electron is 9.10939 × 10–31
  3. All the isotopes of a given element show same chemical properties
  4. Protons and electrons are, collectively known as
  5. Dalton’s atomic theory, regarded the atom as an ultimate particle of matter. Choose the correct answer from the options given
Options:
  • A, B and C only
  • C, D and E only
  • A and E only
  • B, C and E only
Answer: (d)
Solution: Answer is option 4
A: Atoms of all elements are composed of 3 fundamental particles i.e. e–, p+ and nu. B: Mass of e– is 9.10939 × 10-31 kg
C: All isotope of a given element shown same chemical properties as they have same no. of valence e–.
D: Nucleons = P+ + nu
E: Dalton’s atomic theory, regarded the atom as an ultimate particle of matter.
 
 
Question 52: Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: A reaction can have zero activation energy.
Reasons R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below : CO
Options:
  • Both A and R are true and R is the correct explanation of A
  • Both A and R are true and R is not the correct explanation of A
  • A is true but R is false.
  • A is false but R is true.
Answer: (b)
Solution: A reaction can have Ea = O
The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold values is called activation energy.
Both A & R are true but R is not the correct explanation of A
 
Question 53: A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AxBy, then the value of x + y is in option
Options:
  • 5
  • 4
  • 3
 
 
 
 
(d)  2 Answer: (a) Solution:
Effective number of atoms
Contribution of B = 4, Tetrahedral voids = 8
Contribution of A → 1 T.TH void 8
3                    3
 
  

A8 B4 ⇒ A2B3
3
x + y = 5
 
Question 54: Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R
Assertion A: Metallic sodium dissolves in liquid ammonia giving a deep blue solution. which is paramagnetic.
Reasons R: The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R. is false.
  • A is false but R is true.
Answer: (c)
Solution: Metallic Na dissolves in liquid NH3 giving a deep blue solution, which is paramagnetic
Na + (x + y) NH3 → [Na(NH3)x]+ + [e(NH3)y]–
Assertions true
The deep blue colour is because of ammoniate electrons. So, reason is false.
 
Question 55: Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is
NH3, AICl3, BeCl2 CCl4. PCl5
Options:
  • 3
  • 2
  • 4
  • 1
Answer: (a)
Solution: AlCl3 and BeCl2 ⇒ Hypovalent PCl5 ⇒ Hypervalent
 
Question 56: Which amongst the following molecules on polymerization produces neoprene?
Options:
(a) H2C = CH–CH = CH2 (b)
 
 
 
 
 
  

(c) H2C = CH– C ≡ CH (d)
Answer: (b) Solution:
 
 
Question 57: In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe3+ due to the formation of
 
Options:
  • Fe4[Fe(CN)6]3 xH2O
  • NaSCN
  • [Fe(CN)5NOS]4–
  • [Fe(SCN)]2+
Answer: (d)
Solution: SCN– reacts with Fe3+ to form the complex [Fe(SCN)]2+ Real Blood Color [Test for both S and N]
 
 
Question 58: Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is :
 
Options:
  • 16
  • 32
  • 30
(d)  18 Answer: (b) Solution:
 
  
 
Product: CH4
 
 
 
 
Molecular mass: 16 2 mol of CH4 → 32 g
 
Question 59: Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
Options:
  • Chlordiazepoxide
  • Meprobamate
  • Valium
  • Veronal
Answer: (d)
Solution: Barbiturates are hypnotic (Sleep producing) Eg:- Veronal, Amytal, Nembutal, etc
 
 
Question 60: The conductivity of centimolar solution of KCl at 25°C is 0.210 ohm–1 cm–1 and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is
 
Options:
(a) 1.34 cm–1
(b) 3.28 cm–1
(c) 1.26 cm–1
(d) 3.34 cm–1
Answer: (c)
Solution: Cell Constant G* = Specific Conductance × R given R = 60 ohms
K = 0.0210 ohm-1cm-1 G* = 0.0210 × 60
= 1.26 cm-1
 
 
Question 61: Complete the following reaction
C is                Options: (a)
 
 
 
 
(b)
(c)
(d)
Answer: (d) Solution:
 
  
 
Question 62: Homoleptic complex from the following complexes is
Options:
  • Potassium trioxalatoaluminate (III)
  • Diamminechloridonitrito-N-platinum (II)
  • Pentaamminecarbonatocobalt (III) chloride
  • Triamminetriaquachromium (III) chloride
Answer: (a) Solution: K3[Al(ox)3]
 
 
Question 63: The relation between nm, (nm = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l ) , is
 
Options:
  • l = nm -1
2
  • l = 2nm +1
  • nm = 2l2 +1
 
 
 
  • nm= l + 2 Answer: (a) Solution: nm = 2l +1
l = nm -1
2
 
Question 64: The stability of Cu2+ is more than Cu2+ salts in aqueous solution due to
Options:
  • First ionisation enthalpy
  • Enthalpy of atomization
  • Hydration energy
  • Second ionisation enthalpy
Answer: (c)
 
Solution: Hydration energy 𝖺 charge µ
1
 
size
 
 
Question 65: Taking stability as the factor, which one of the following represents correct relationship?
Options:
  • TICI3 > TICI
  • InI3 > InI
  • AlCl > AlCl3
  • TlI > TII3
Answer: (d)
Solution: Inert pair effect.
 
Question 66: Which one is an example of heterogenous catalysis?
Options:
  • Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen
  • Hydrolysis of sugar catalysed by H+ ions
  • Decomposition of ozone in presence of nitrogen monoxide
  • Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron
 
  

Answer: (d) Solution:
Reactants and catalyst are in different phases.
 
 
 
 
 
Question 67: The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:
Options:
(a) 11, 2, 0
(b) 12, 3, 0
(c) 11, 3, 1
(d) 12, 2, 1
 
  

Answer: (c) Solution:
In the given structures, 1 lone pair
𝜎 bonds : 11
𝜋 bonds : 3 Lone pair : 1
 
Question 68: The correct order of energies of molecular orbitals of N2 molecule, is
Options:
  • σ1s < σ*1s < σ2s < σ*2s < (π2px = π2py) < σ2pz < (π*2px = π*2py) < σ*2pz
  • σ1s < σ*1s < σ2s < σ*2s < σ2pz < (π2px = π2py) < (π*2px = π*2py) < π*2pz
  • σ1s < σ*1s < σ2s < σ*2s < σ2pz < σ*2pz < (π2px = π2py) < (π*2px = π*2py)
  • σ1s < σ*1s < σ2s < σ*2s < (π2px = π2py) < (π*2px = π*2py) < σ2pz < σ*2pz
Answer: (a)
Solution: For the species having total electrons less than or equal to 14, the molecular electronic configuration is written as:
𝜎1s < 𝜎* 1s < 𝜎 2s < 𝜎* 2s < 𝜋 2px = 𝜋2py < 𝜎 2pz < 𝜋* 2px = 𝜋* 2py < 𝜎*2pz
 
Question 69: Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R
Assertion A: Helium is used to dilute oxygen in diving apparatus.
Reason R: Helium has high solubility in O2.
In the light of the above statements, choose the correct answer from the options given below
Options:
  • Both A and R are true and R correct explanation of A
  • Both A and R are true and R is NOT the correct explanation of A
  • A is true but R is false
  • A is false but R is true
Answer: (b)
 
 
 
 
Solution: Both A and R are true and R is NOT the correct explanation of A
 
 
Question 70: For a certain reaction, the rate = k[A]2[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
 
Options:
  • Decrease by a factor of nine
  • Increase by a factor of six
  • Increase by a factor of nine
  • Increase by a factor of three
Answer: (c) Solution:
 
 
  

Question 71: Identify product (A) in the following reaction:
Options:
 
  

(a)
(b)
(c)
 
 
 
 
 
 
  

(d)
Answer: (a) Solution:
 
Question 72: Which of the following reactions will NOT give primary amine as the product?
Options:
 
  

(a)
(b)
 
  

(c)
(d)
Answer: (c)
Solution: Methyl isocyanide would produce secondary amine
3                                                       3                        3
 
CH NC ¾L¾iAlH¾4 ®CH NHCH
 
Question 73: Which amongst the following options are correct graphical representation of Boyle’s Law?
Options:
(a)
 
 
 
 
 
  

(b)
(c)
(d)
 
  
Answer: (b) Solution: pV = nRT
 
 
 
 
m 𝖺 T
T3 > T2 > T1
 
Question 74: Amongst the given options which of the following molecules/ ion acts as a Lewis acid?
Options:
  • NH3
  • H2O
  • BF3
  • OH–
Answer: (c)
Solution: BF3 is hypovalent compound
 
Question 75: The element expected to form largest ion to achieve the nearest noble gas configuration is
Options:
  • O
  • F
  • N
(d)  Na Answer: (c) Solution:
O → O2- F → F– N → N3-
Na → Na+
For isoelectronic species Z ↑ size ↓
 
Question 76: The given compound
is an example of             .
Options:
  • Benzylic halide
  • Aryl halide
  • Allylic halide
  • Vinylic halide Answer: (c) Solution:
 
 
 
 
 
Halogen is attached to a
sp3 -C which is further bonded to
sp2 – C [Ally system] Hence allyl halide
 
Question 77: Given below are two statements :
Statement I: A unit formed by the attachment of a base to 1’ position of sugar is known as nucleoside.
Statement II: When nucleoside is linked to phosphorous acid at 5’ -position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below :
Options:
  • Both Statement I and Statement II are true
  • Both Statement I and Statement II are false
  • Statement I is true but Statement II is false
  • Statement I is false but Statement II is true
Answer: (c)
 
  

Solution: A unit formed by the attachment of a base to 1’ position of sugar is known as nucleoside
When nucleoside is linked to phosphoric acid at 5′-position of sugar moiety, we get a nucleotide.
 
  
 
Question 78: Intermolecular forces are forces of attraction and repulsion between interacting particles that will include
  1. dipole – dipole forces
 
 
 
 
  1. dipole – induced dipole forces
  2. hydrogen bonding
  3. covalent bonding
  4. dispersion forces
Choose the most appropriate answer from the options given below :
Options:
  • B, C, D, E are correct
  • A, B, C, D are correct
  • A, B, C, E are correct
  • A, C, D, E are correct
Answer: (c)
Solution: Covalent bonding is n interatomic force (Primary force) Remaining all are intermolecular forces
 
Question 79: Which of the following statements are NOT correct?
  1. Hydrogen is used to reduce heavy metal oxides to
  2. Heavy water is used to study reaction
  3. Hydrogen is used to make saturated fats from
  4. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any elements.
  5. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below:
Options:
  • B, D only
  • D, E only
  • A, B, C only
  • B, C, D, E only
Answer: (b)
Solution: Statements D and E are wrong
→ H.H Bond dissociation enthalpy is greater than C – C bond.
→ Hydrogen reduces oxicles of metals that are less active than Iron
 
Question 80: Which one of the following statements is correct?
Options:
  • The bone in human body is an inert and unchanging substance.
  • Mg plays roles in neuromuscular function and interneuronal transmission
  • The daily requirement of Mg and Ca in the human body is estimated to be 2-0.3 g.
  • All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor
 
 
 
 
Answer: (c)
Solution: The daily requirement in the human body has been estimated to be 200 – 300 mg 0.2-
0.3 gams.
All enzymes that utilise ATP in phosphate transfer require magnesium.
 
 
Question 81: Match List-I with List-II.
List-I
List-II
A. Coke
I. Carbon atoms are sp3 hybridised
B. Diamond
II. Used as a dry lubricant
C. Fullerene
III. Used as a reducing agent
D. Graphite
IV. Cage like molecules
Choose the correct answer from the options given below :
Options:
  • A-II, B-IV, C-I, D-III
  • A-IV, B-I, C-II, D-III
  • A-III, B-I, C-IV, D-II
  • A-III, B-IV, C-I, D-II
Answer: (c)
Solution: A-III, B-I, C-IV, D-II
 
Question 82: The right option for the mass of CO2 produced by heating 20 g of 20% pure limestone
 
is (Atomic mass of Ca = 40) [CaCO3
Options:
(a) 1.76 g
(b) 2.64 g
(c) 1.32 g
(d) 1.12 g Answer: (b) Solution: 2.64 g
¾1¾200¾K® CaO+CO2]
 
 
Question 83: Identify the product in the following reaction:
Options:
(a)
(b)
 
 
 
 
(c)
(d)
Answer: (b) Solution:
 
Question 84: Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R
Assertion A: In equation ∆rG = –nFEcell’ value of ∆rG depends on n.
Reasons R: Ecell is an intensive property and ∆rG is an extensive property.
In the light of the above statements, choose the correct answer from the options given below
Options:
  • Both A and R are true and R is the correct explanation of A
  • Both A and R are true and R is NOT the correct explanation of A
  • A is true but R is false
  • A is false but R is true
Answer: (b)
Solution: ∆rG = – nFEcell and ∆rG depends on n
A is correct
Ecell is intensive property and ∆rG is an extensive property R is also correct
Reason is not the correct explanation for assertion
 
 
 
 
 
 
  

Question 85: Consider the following reaction and identify the product (P).
Options:
 
  

(a)
(b) CH3CH = CH – CH3 (c)
 
  

(d)
Answer: (a) Solution:
 
 
 
 
 
Question 86: Consider the following compounds/species:
The number of compounds/species which obey Huckel’s rule is              .
Options:
  • 4
  • 6
  • 2
 
 
 
 
(d)  5 Answer: (a) Solution:
(i)
4n+2 = 10
n=2 (valid) (ii)
4n+2 = 6
 
  

n=1 (valid) (iii)
4n+2 (not valid) (iv)
 
 
4n+2 (not valid) (v)
4n+2 = 2
n=0 (valid) (vi)
4n+2 (not valid) (vii)
4n+2 = 14
n=3 (valid)
 
 
Question 87: Identify the major product obtained in the following reaction
 
 
 
 
3–OH  ¾D¾® major product
Options:
(a)
 
  

(b)
(c)
 
  

(d)
Answer: (c) Solution:
 
 
 
 
 
Question 88: Which of the following statements are INCORRECT?
  1. All the transition metals except scandium form MO oxides which are
  2. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc2O3 to Mn2O7.
  3. Basic character increases from V2O3 to V2O4 to V2O5.
  4. V2O4 dissolves in acids to give VO43–
  5. CrO is basic but Cr2O3 is amphoteric.
Choose the correct answer from the options given below:
Options:
  • A and E only
  • B and D only
  • C and D only
  • B and C only
Answer: (c)
Solution: V2O4 dissolves in acids to give VO2+ salts D is wrong
As O.NO. ↑ acidic character ↑ Basic nature : V2O3 > V2O4 > V2O5
 
Question 89: Which amongst the following be most readily dehydrated under acidic conditions?
Options:
 
  

(a)
(b)
 
 
 
 
 
  

(c)
(d)
 
  

Answer: (d) Solution:
Most stable carbocation as -I of NO2 is minimum and 5 𝖺 – H So hence undergo dehydration easily
 
 
  

Question 90: Consider the following reaction :
Options:
 
  

(a)
(b)
(c)
 
  

(d)
 
 
 
 
 
  

Answer: (c) Solution:
 
 
Question 91: The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
 
Options:
  • Fe2O3 + CO → 2FeO + CO2
  • FeO + CO → Fe + CO2
  • C + CO2 → 2CO
  • CaO + SiO2 → CaSiO3
Answer: (a)
Solution: The reactions that take place in a blast furnace between 900 k to 1500 k are: 3Fe2O3 + CO → 2Fe3O4 + CO2
FeO + CO → Fe + CO2 C + CO2 → 2CO
CaO + SiO2 → CaSiO3
 
 
Question 92: Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
 
Options:
  • ∆H = ∆U – ∆ngRT
  • ∆H = ∆U + ∆ngRT
  • ∆H – ∆U = –∆nRT
  • ∆H + ∆U = ∆nR
Answer: (b)
Solution: ∆H = ∆U + ∆ngRT
 
Question 93: On balancing the given redox reaction,
 
 
 
 
 
the coefficients a, b and c are found to be, respectively-
Options:
(a) 1, 3, 8
(b) 3, 8, 1
(c) 1, 8, 3
(d) 8, 1, 3
Answer: (a)
Solution: Cr O 2– + 3SO 2– + 8H+ → 2Cr3+ + 3SO 2– + 4 H O
2    7                  3                                                     4                 2
 
Question 94: What fraction of one edge centred octahedral void lies in one unit cell of fcc?
Options:
  • 1 2
  • 1 3
  • 1 4
  • 1 12
Answer: (c)
Solution: 1
4
 
Question 95: Given below are two statements :
 
Statement I: The nutrient deficient water bodies lead to eutrophication
 
Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies.
 
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statement I and Statement II are true
  • Both Statement I and Statement II are false
  • Statement I is correct but Statement II is false
  • Statement I is incorrect but Statement II is true
Answer: (d)
Solution: Eutrophication is a process in which nutrient enriched water bodies support a dense plant population which kills animal life by depriving it of O2 and results in loss of biodiversity.
 
 
Question 96: The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L–1, respectively at 300 K. ∆Gº for the reaction is (R = 2 cal/mol K)
 
 
 
 
Options:
(a) 1372.60 cal
(b) –137.26 cal
(c) –1381.80 cal
(d) –13.73 cal
Answer: (c)
Solution: –1381.80 cal
 
Question 97: Which complex compound is most stable?
Options:
 
  

(a)
(b)
 
  

(c)
(d)
Answer: (c)
Solution: Since there are tw 5-membered rights (Chelation) [C0Cl2(en)2]NO3 will be most stable
 
Question 98: Match List-I with List–II :
List-I (Oxoacids of Sulphur)
List-II (Bonds)
A. Peroxodisulphuric acid
I. Two S–OH, Four S=O, One S–O–S
B. Sulphuric acid
II. Two S–OH, One S=O
C. Pyrosulphuric acid
III. Two S–OH, Four S=O, One S–O–O–S
D. Sulphurous acid
IV. Two S–OH, Two S=O
Choose the correct answer from the options given below.
Options:
  • A–I, B–III, C–II, D–IV
  • A–III, B–IV, C–I, D–II
  • A–I, B–III, C–IV, D–II
  • A–III, B–IV, C–II, D–I
Answer: (b)
Solution: A–III, B–IV, C–I, D–II
 
Question 99: Pumice stone is an example of
Options:
  • Sol
  • Gel
  • Solid sol
  • Foam
 
 
Answer: (c) Solution: Solid sol
 
 
  

Question 100: Identify the final product [D] obtained in the following sequence of reactions.
 
Options:
 
  

(a)
(b)
 
  

(c) C4H10 (d)
Answer: (a) Solution:
 
  
 
 
NEET 2023
Biology
 
Question 101: Given below are two statements:
Statement I: The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II: Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporating cooling.
In the light of the above statements, choose the most appropriate answer from the options given below:
Options:
  • Both Statement I and Statement II are
  • Both Statement I and Statement II are not
  • Statement I is correct but Statement II is
  • Statement I is incorrect but Statement II is correct.
Answer: (a)
Question 102: In gene gun method used to introduce alien DNA into host cells, microparticles
of                metal are used.
Options:
  • Copper
  • Zinc
  • Tungsten or gold
  • Silver
Answer: (c)
Question 103: Given below are two statements: One is labelled as Assertion A and the other
is labelled as Reason R:
Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R: Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below:
Options:
  • Both A and R are correct and R is the correct explanation of
  • Both A and R are correct but R is NOT the correct explanation of
  • A is correct but R is not
  • A is not correct but R is
Answer: (a)
 
Question 104: Unequivocal proof that DNA is the genetic material was first proposed by
Options:
  • Frederick Griffith
  • Alfred Hershey and Martha Chase
  • Avery, Macleoid and McCarthy
  • Wilkins and Franklin
Answer: (b)
 
 
Question 105: The thickness of ozone in a column of air in the atmosphere is measured in terms of:
Options:
  • Dobson units
  • Decibels
  • Decameter
  • Kilobase
Answer: (a)
 
Question 106: In tissue experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as:
Options:
  • Differentiation
  • Dedifferentiation
  • Development
  • Senescence
Answer: (b)
Question 107: Large, colourful, fragrant flowers with nectar are seen in:
Options:
  • insect pollinated plants
  • bird pollinated plants
  • bat pollinated plants
  • wind pollinated plants
Answer: (a)
Question 108: Frequency of recombination between gene pairs on some chromosome as a
measure of the distance between genes to map their position on chromosome, was used for the first time by
Options:
  • Thomas Hunt Morgan
  • Sutton and Boveri
  • Alfred Sturtevant
  • Henking
Answer: (c)
Question 109: Which of the following stages of meiosis involves division of centromere?
Options:
  • Metaphase I
  • Metaphase II
  • Anaphase II
  • Telophase
Answer: (c)
 
Question 110: What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Options:
  • Transcription of rRNAs (28S, 18S and 8S)
  • Transcription of tRNA, 5srRNA and snRNA
  • Transcription of precursor of mRNA
 
 
  • Transcription of only snRNAs
Answer: (b)
 
Question 111: Among ‘The Evil Quartet’ which one is considered the most important cause driving extinction of species?
Options:
  • Habitat loss and fragmentation
  • Over exploitation for economic gain
  • Alien species invasions
  • Co-extinctions
Answer: (a)
 
Question 112: Given below are two statements:
Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II: Exarch condition is the most common feature of the root system
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statement I and Statement II are
  • Both Statement I and Statement II are not
  • Statement I is correct but Statement II is false.
  • Statement I is incorrect but Statement II is true.
Answer: (d)
Question 113: Axile placentation is observed in
Options:
  • Mustard, Cucumber and Primrose
  • China rose, Beans and Lupin
  • Tomato, Dianthus and Pea
  • China rose, Petunia and Lemon
Answer: (d)
Question 114: Expressed Sequence Tags (ESTs) refers to
Options:
  • All genes that are expressed as
  • All genes that are expressed as
  • All genes whether expressed or
  • Certain important expressed
Answer: (a)
 
Question 115: What is the function of tassels in the corn cob?
Options:
  • To attract insects
  • To trap pollen grains
  • To disperse pollen grains
  • To protect seeds
Answer: (b)
 
Question 116: Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
 
 
Options:
  • Indole-3-butyric Acid
  • Gibberellic Acid
  • Zeatin
  • Abscisic Acid
Answer: (b)
 
Question 117: In the equation
 
  
 
GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is           .
Options:
  • Photosynthetically active radiation
  • Respiratory quotient
  • Respiratory loss
  • Reproductive allocation
Answer: (c)
Question 118: Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the
stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Options:
  • Diadelphous and Dithecous anthers
  • Polyadelphous and epipetalous stamens
  • Monoadelphous and Monothecous anthers
  • Epiphyllous and Dithecous anthers
Answer: (a)
Question 119: In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo
sac sequentially are:
Options:
  • Synergids, Primary endosperm nucleus and zygote
  • Antipodals, synergids, and primary endosperm nucleus
  • Synergids, Zygote and Primary endosperm nucleus
  • Synergids, antipodals and Polar nuclei
Answer: (c)
 
Question 120: Which hormone promotes internode/petiole elongation in deep water rice?
Options:
  • GA3
  • Kinetin
  • Ethylene
(d) 2, 4-D
Answer: (c)
 
Question 121: Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
 
 
Assertion A: Late wood has fewer xylary elements with narrow vessels.
Reason R: Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R is not
  • A is not false but R is true.
Answer: (a)
 
Question 122: Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: ATP is used at two steps in glycolysis.
Reason R: First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R is not
  • A is not false but R is true.
Answer: (a)
Question 123: Identify the correct statements:
  1. Detrivores perform
  2. The humus is further degraded by some microbes during
  3. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called
  4. The detritus food chain begins with living organisms.
  5. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :
Options:
  • A, B, C only
  • B, C, D only
  • C, D, E only
  • D, E, A only
Answer: (d)
Question 124: The process of appearance of recombination nodules occurs at which sub stage
of prophase I in meiosis?
Options:
  • Zygotene
  • Pachytene
  • Diplotene
  • Diakinesis
Answer: (b)
 
Question 125: How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?
Options:
 
 
  • 12ATP and 12 NADPH2
  • 18 ATP and 12 NADPH2
  • 12 ATP and 16 NADPH2
  • 18ATP and 16 NADPH2
Answer: (b)
 
Question 126: The phenomenon of pleiotropism refers to
Options:
  • presence of several alleles of a single gene controlling a single
  • presences of two alleles, each of the two genes controlling a single
  • a single gene affecting multiple phenotypic
  • more than two genes affecting a single
Answer: (c)
Question 127: Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Options:
  • Bright red colour
  • Bright blue colour
  • Bright yellow colour
  • Bright orange colour
Answer: (d)
Question 128: The reaction centre in PS II has an absorption maxima at
Options:
  • 680 nm
  • 700 nm
  • 660 nm
  • 780 nm
Answer: (a)
Question 129: During the purification process for recombinant DNA technology, addition of
chilled ethanol precipitates out
Options:
  • RNA
  • DNA
  • Histones
  • Polysaccharides
Answer: (b)
 
Question 130: Which micronutrient is required for splitting of water molecule during photosynthesis?
Options:
  • manganese
  • molybdenum
  • magnesium
  • copper
Answer: (a)
 
Question 131: Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
 
 
Options:
  • Osmosis
  • Facilitated Diffusion
  • Passive Transport
  • Active transport
Answer: (d)
 
Question 132: Among eukaryotes, replication of DNA takes place in
Options:
  • M phase
  • S phase
  • G1 phase
  • G2 phase
Answer: (b)
Question 133: Cellulose does not form blue colour with Iodine because
Options:
  • It is a
  • It is a helical
  • It does not contain complex helices and hence cannot hold iodine
  • It breakes down when iodine reacts with
Answer: (c)
Question 134: The historic Convention on Biological Diversity, ‘The Earth Summit’ was held
in Rio de Janeiro in the year:
Options:
(a) 1985
(b) 1992
(c) 1986
(d) 2002
Answer: (b)
Question 135: Identify the pair of heterosporous pteridophytes among the following:
Options:
  • Lycopodium and Selaginella
  • Selaginella and Salvinia
  • Psilotum and Salvinia
  • Equisetum and Salvinia
Answer: (b)
 
Question 136: Match List I with List II:
List I
List II
A. M Phase
I. Proteins are synthesized
B. G2 Phase
II. Inactive phase
C. G1 Phase
III. Interval between mitosis and initiation of DNA replication
D. G1 Phase
IV. Equational division
Choose the correct answer from the options given below:
Options:
  • A-III, B-II, C-IV, D-I
  • A-IV, B-II, C-I, D-III
 
 
  • A-IV, B-I, C-II, D-III
  • A-II, B-IV, C-I, D-III
Answer: (c)
 
Question 137: Match List I with List II:
List I
List II
A. Iron
I. Synthesis of auxin
B. Zinc
II. Component of nitrate reductase
C. Boron
III. Activation of catalase
D. Molybdenum
IV. Cell elongation and differentiation
Choose the correct answer from the options given below:
Options:
  • A-III, B-II, C-I, D-IV
  • A-II, B-III, C-IV, D-I
  • A-III, B-I, C-IV, D-II
  • A-II, B-IV, C-I, D-III
Answer: (c)
Question 138: Match List I with List II:
List I
List II
A. Cohesion
I. More attraction in liquid phase
B. Adhesion
II. Mutual attraction among water molecules
C. Surface tension
III. Water loss in liquid phase
D. Guttation
IV. Attraction towards polar surfaces
Choose the correct answer from the options given below:
Options:
  • A-II, B-IV, C-I, D-III
  • A-IV, B-III, C-II, D-I
  • A-III, B-I, C-IV, D-II
  • A-II, B-I, C-IV, D-III
Answer: (a)
Question 139: How many different proteins does the ribosome consist of?
Options:
  • 80
  • 60
  • 40
  • 20
Answer: (a)
 
Question 140: Match List I with List II:
List I
List II
A. Oxidative decarboxylation
I. Citrate synthase
B. Glycolysis
II. Pyruvate dehydrogenase
C. Oxidative phosphorylation
III. Electron transport system
D. Tricarboxylic acid cycle
IV. EMP pathway
Choose the correct answer from the options given below:
Options:
  • A-III, B-IV, C-II, D-I
 
 
  • A-II, B-IV, C-I, D-III
  • A-III, B-I, C-II, D-IV
  • A-II, B-IV, C-III, D-I
Answer: (d)
 
Question 141: Match List I with List II:
List I (Interaction)
List II
(Species A and B)
A. Mutualism
I. + (A), O(B)
B. Commensalism
II. – (A), O(B)
C. Amensalism
III. + (A), – (B)
D. Parasitism
IV. + (A), + (B)
Choose the correct answer from the options given below:
Options:
  • A-IV, B-II, C-I, D-III
  • A-IV, B-I, C-II, D-III
  • A-IV, B-III, C-I, D-II
  • A-III, B-I, C-IV, D-II
Answer: (b)
Question 142: Main steps in the formation of Recombinant DNA are given below. Arrange
these steps in a correct sequence.
  1. Insertion of recombinant DNA into the host
  2. Cutting of DNA at specific location by restriction
  3. Isolation of desired DNA
  4. Amplification of gene of interest using
Choose the correct answer from the options given below:
Options:
  • B, C, D, A
  • C, A, B, D
  • C, B, D, A
  • B, D, A, C
Answer: (c)
Question 143: Given below are two statements:
Statement I: Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II: In general. carnivores are more adversely affected by competition than herbivores. In the light of the above statements
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statement I and Statement II are
  • Both Statement I and Statement II are
  • Statement I is correct but Statement II is false.
  • Statement I is incorrect but Statement II is true.
Answer: (c)
 
Question 144: Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
 
 
Assertion A: A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R is not
  • A is not false but R is true.
Answer: (a)
 
Question 145: Which of the following statements are correct about Klinefelter’s Syndrome?
  1. This disorder was first described by Landon Down (1866).
  2. Such an individual has overall masculine However, the feminine development is also expressed.
  3. The afford individual is short
  4. Physical, psychomotor and mental development is
  5. Such individuals are
Choose the correct answer from the options given below:
Options:
  • A and B only
  • C and D only
  • B and E only
  • A and E only
Answer: (c)
Question 146: Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity
of
Options:
  • Sccinic dehydrogenase
  • Amylase
  • Lipase
  • Dinitrogenase
Answer: (a)
Question 147: Which one of the following statements is NOT correct?
Options:
  • The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic
  • Algal blooms caused by excess of organic matter in water improve water quality and promote
  • Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
  • The amount of some toxic substances of industrial waste venter increases in the organisms at successive trophic
Answer: (b)
 
Question 148: Which of the following combinations is required for chemiosmosis?
Options:
 
 
  • membrane, proton pump, proton gradient, ATP synthase
  • membrane, proton pump, proton gradient, NADP synthase
  • proton pump, electron gradient, ATP synthase
  • proton pump, electron gradient, NADP synthase
Answer: (a)
 
 
Question 149: Identify the correct statements:
 
  1. Lenticels are the lens-shaped openings permitting the exchange of
 
  1. Bark formed early in the season is called hard bark.
 
  1. Bark is a technical term that refers to all tissues exterior to vascular cambium.
 
  1. Bark refers to periderm and secondary
 
  1. Phellogen is single-layered in
 
Choose the correct answer from the options given below :
Options:
  • B, C and E only
  • A and D only
  • A, B and D only
  • B and C only
Answer: (b)
Question 150: Given below are two statements: One is labelled as Assertion A and the other
is labelled as Reason R:
Assertion A: In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R: Air currents carry the pollen grains to the mouth of the archegonia where the gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R is not
  • A is not false but R is true.
Answer: (c)
 
Question 151: Which of the following is not a cloning vector?
Options:
  • BAC
  • YAC
  • pBR322
  • Probe
Answer: (d)
 
Question 152: Broad palm with single palm crease is visible in a person suffering from
 
 
Options:
  • Down’s syndrome
  • Turner’s syndrome
  • Klinefelter’s syndrome
  • Thalassemia
Answer: (a)
 
Question 153: Which of the following are NOT considered as the part of endomembrane system?
  1. Mitochondria
  2. Endoplasmic Reticulum
  3. Chloroplasts
  4. Golgi complex
  5. Peroxisomes
Choose the most appropriate answer from the options given below:
Options:
  • B and D only
  • A, C and E only
  • A and D only
  • A, D and E only
Answer: (b)
Question 154: Match List I with List II:
List I
List II
A. Taenia
I. Nephridia
B. Paramoecium
II. Contractile vacuole
C. Periplaneta
III. Flame cells
D. Pheretima
IV. Urecose gland
Choose the correct answer from the options given below:
Options:
  • A-I, B-II, C-III, D-IV
  • A-I, B-II, C-IV, D-III
  • A-III, B-II, C-IV, D-I
  • A-II, B-I, C-IV, D-III
Answer: (c)
Question 155: Given below are two statements: One is labelled as Assertion A and the other
is labelled as Reason R:
Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care programme.
Reason R: Ban on aminocentesis checks increasing menace of female foeticide
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R is not false.
  • A is false but R is true.
Answer: (d)
 
Question 156: Given below are two statements:
 
 
Statement I: Ligaments are dense irregular tissue.
Statement II: Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statements I and II are true
  • Both statements I and II are false
  • Statement I is true but Statement II is false
  • Statement I is false, but Statement II is true
Answer: (b)
 
Question 157: Match List I with List II:
List I
List II
A. P-wave
I. Beginning of systole
B. Q-wave
II. Repolarisation of ventricles
C. QRS complex
III. Depolarisation of atria
D. T-wave
IV. Depolarisation of ventricles
Choose the correct answer from the options given below:
Options:
  • A-III, B-I, C-IV, D-II
  • A-IV, B-III, C-II, D-I
  • A-II, B-IV, C-I, D-III
  • A-I, B-II, C-III, D-IV
Answer: (a)
Question 158: Match List I with List II:
List I (Cells)
List II (Secretion)
A. Peptic cells
I. Mucus
B. Goblet cells
II. Bile juice
C. Oxyntic cells
III. Proenzyme pepsinogen
D. Hepatic cells
IV. HCl and intrinsic factor for absorption of vitamin B12
Choose the correct answer from the options given below:
Options:
  • A-IV, B-III, C-I, D-I
  • A-II, B-I, C-III, D-IV
  • A-III, B-I, C-IV, D-II
  • A-II, B-IV, C-I, D-III
Answer: (c)
 
Question 159: Match List I with List II:
List I
List II
A. Vasectomy
I. Oral method
B. Coitus interrupts
II. Barrier method
C. Cervical caps
III. Surgical method
D. Saheli
IV. Natural method
Choose the correct answer from the options given below:
Options:
  • A-III, B-I, C-IV, D-II
  • A-III, B-IV, C-I, D-I
 
 
  • A-II, B-III, C-I, D-IV
  • A-IV, B-II, C-I, D-III
Answer: (b)
 
Question 160: Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statements I and II are
  • Both statements I and II are
  • Statement I is true but Statement II is
  • Statement I is false, but Statement II is true.
Answer: (a)
Question 161: Given below are two statements: One is labelled as Assertion A and the other
is labelled as Reason R:
Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R is not
  • A is not false but R is true.
Answer: (c)
Question 162: Given below are two statements:
Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statements I and II are
  • Both statements I and II are
  • Statement I is true but Statement II is
  • Statement I is false, but Statement II is true.
Answer: (a)
 
Question 163: Match List I with List II:
List I
List II
A. Gene ‘a’
I. b -galactosidase
B. Gene ‘y’
II. Transacetylase
C. Gene ‘i’
III. Permease
D. Gene ‘z’
IV. Repressor protein
 
 
Choose the correct answer from the options given below:
Options:
  • A-II, B-I, C-IV, D-III
  • A-II, B-III, C-IV, D-I
  • A-III, B-IV, C-I, D-II
  • A-III, B-I, C-IV, D-II
Answer: (b)
 
Question 164: Match List I with List II:
List I
List II
A. Ringworm
I. Haemophilus influenzae
B. Filariasis
II. Trichophyton
C. Malaria
III. Wuchereria bancrofti
D. Pneumonia
IV. Plasmodium vivax
Choose the correct answer from the options given below:
Options:
  • A-II, B-III, C-IV, D-I
  • A-II, B-III, C-I, D-IV
  • A-III, B-II, C-I, D-IV
  • A-III, B-II, C-IV, D-I
Answer: (a)
Question 165: Which of the following functions is carried out by cytoskeleton in a cell?
Options:
  • Nuclear division
  • Protein synthesis
  • Motility
  • Transportation
Answer: (c)
Question 166: Which of the following statements is correct?
Options:
  • Eutrophication refers to increase in domestic sewage and waste water in
  • Biomagnification refers to increase in concentration of the toxicant at successive trophic
  • Presence of large amount of nutrients in water restricts ‘Algal Bloom’
  • Algal Bloom decreases fish mortality
Answer: (b)
 
Question 167: Match List I with List II:
List I
List II
A. Heroin
I. Effect on cardiovascular system
B. Marijuana
II. Slow down body function
C. Cocaine
III. Painkiller
D. Morphine
IV. Interfere with transport of dopamine
Choose the correct answer from the options given below:
Options:
  • A-II, B-I, C-IV, D-III
  • A-I, B-II, C-III, D-IV
  • A-IV, B-III, C-II, D-I
 
 
  • A-III, B-IV, C-I, D-II
Answer: (a)
 
Question 168: Radial symmetry is NOT found in adults of phylum               .
Options:
  • Ctenophora
  • Hemichordata
  • Coelenterata
  • Echinodermata
Answer: (b)
 
Question 169: Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statements I and Statement II are
  • Both statements I and Statement II are
  • Statement I is correct but Statement II is false.
  • Statement I is incorrect but Statement II is true.
Answer: (d)
Question 170: Which of the following statements are correct regarding female reproductive
cycle?
  1. In non-primate mammals cyclical changes during reproduction are called oestrus
  2. First menstrual cycle begins at puberty and is called
  3. Lack of menstruation may be indicative of
  4. Cyclic, menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below: Options:
  • A and D only
  • A and B only
  • A, B and C only
  • A, C and D only
Answer: (d)
Question 171: Select the correct group/set of Australian Marsupials  exhibiting adaptive
radiation.
Options:
  • Tasmanian wolf, Bobcat, Marsupial mole
  • Numbat, Spotted cuscus, Flying phalanger
  • Mole, Flying squirrel, Tasmanian tiger cat
  • Lemur, Anteater, Wolf
Answer: (b)
 
Question 172: Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
Options:
 
 
  • Recombinant DNA Technology
  • Serum and Urine analysis
  • Polymerase Chain Reaction (PCR) technique
  • Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
Answer: (b)
 
Question 173: Match List I with List II:
List I
(Type of Joint)
List II
(Found between)
A. Cartilaginous Joint
I. Between flat skull bones
B. Ball and Socket Joint
II. Between adjacent vertebrae in vertebral column
C. Fibrous Joint
III. Between carpal and metacarpal of thumb
D. Saddle Joint
IV. Between Humerus and Pectoral Girdle
Choose the correct answer from the options given below:
Options:
  • A-III, B-I, C-II, D-IV
  • A-II, B-IV, C-I, D-III
  • A-I, B-IV, C-III, D-II
  • A-II, B-IV, C-III, D-I
Answer: (b)
Question 174: Match List I with List II:
List I
(Interacting species)
List II
(Name of Interaction)
A. A Leopard and a Lion in a forest/grassland
I. Competition
B. A Cuckoo laying egg in a Crow’s nest
II. Brood parasitism
C. Fungi and root of a higher plant in Mycorrtizae
III. Mutualism
D. A cattle egret and a Cattle in a field
IV. Commensalism
Choose the correct answer from the options given below:
Options:
  • A-I, B-II, C-III, D-IV
  • A-I, B-II, C-IV, D-III
  • A-III, B-IV, C-I, D-II
  • A-II, B-III, C-I, D-IV
Answer: (a)
Question 175: Vital capacity of lung is                .
Options:
  • IRV + ERV
  • IRV + ERV + TV + RV
  • IRV + ERV + TV – RV
  • IRV + ERV + TV
Answer: (d)
 
Question 176: Match List I with List II:
List I
List II
A. Fovea
I. Visible coloured portion of eye that regulates diameter of pupil.
B. Iris
II. External layer of eye formed of dense connective tissue.
 
 
 
C.        Blind spot
III. Point of greatest visual acuity or resolution.
D. Sclera
IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent.
Choose the correct answer from the options given below:
Options:
  • A-III, B-I, C-IV, D-II
  • A-IV, B-III, C-II, D-I
  • A-I, B-IV, C-III, D-II
  • A-II, B-I, C-III, D-IV
Answer: (a)
 
Question 177: Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
Options:
  • Sphincter of Oddi
  • Ileo – Caecal valve
  • Gastro – Oesphageal sphincter
  • Pyloric sphincter
Answer: (b)
Question 178: Which of the following common sexually transmitted diseases is completely
curable when detected early and treated properly?
Options:
  • Genital herpes
  • Gonorrhoea
  • Hepatitis-B
  • HIV Infection
Answer: (b)
Question 179: Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C- terminal) and the right end represented by last amino acid (N-terminal)
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of a type and
two subunits of b type.)
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statement I and Statement II are
  • Both statement I and Statement II are
  • Statement I is correct but Statement II is false.
  • Statement I is incorrect but Statement II is true.
Answer: (d)
 
Question 180: Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations. In the light of the above statements, choose the most appropriate answer from the options given below:
Options:
  • Both Statement I and Statement II are
 
 
  • Both statement I and Statement II are
  • Statement I is correct but Statement II is false.
  • Statement I is incorrect but Statement II is true.
Answer: (c)
 
Question 181: In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Options:
  • TH cells
  • B-lymphocytes
  • Basophils
  • Eosinophils
Answer: (a)
Question 182: Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both Statements 1 and 2 are true
  • Both statements 1 and 2 are false
  • Statement 1 is true, but Statement 2 is false
  • Statement 1 is false, but Statement 2 is true
Answer: (a)
Question 183: Given below are two statements: one is labelled as Assertion A and other is
labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below:
Options:
  • Both A and R are true and R is the correct explanation of
  • Both A and R are true but R is NOT the correct explanation of
  • A is true but R is
  • A is false but It is true.
Answer: (b)
Question 184: Match List I with List II.
List I
List II
A. CCK
I. Kidney
B. GIP
II. Heart
C. ANF
III. Gastric gland
D. ADH
IV. Pancreas
Choose the correct answer from the options given below:
Options:
  • A-IV, B-III,C-II,D-I
  • A-III, B-II,C-IV,D-I
  • A-II, B-IV,C-I,D-III
  • A-IV, B-II,C-III,D-I
 
 
Answer: (a)
 
Question 185: Which of the following symbols represents mating between relatives in human pedigree analysis?
Options:
 
  

(a)
(b)
(c)
(d)
Answer: (b)
Question 186: The unique mammalian characteristics are:
Options:
  • Hairs, lymphatic membrane and mammary gland
  • hairs, pinna and mammary glands
  • hairs, pinna and indirect development
  • pinna, monocondylic skull and mammary glands
Answer: (b)
Question 187: Which of the following statements are correct ?
  1. Basophils are most abundant cells of the total
  2. Basophils secrete histamine, serotonin and
  3. Basophils are involved in inflammatory response.
  4. Basophils have kidney shaped nucleus E. Basophils are
Options:
  • D and E only
  • C and E only
  • B and C only
  • A and B only
Answer: (c)
 
 
Question 188: Select the correct statements with reference to chordates.
  1. Presence of a mid-dorsal, solid and double nerve
  2. Presence of closed circulatory
  3. Presence of paired pharyngeal
  4. Presence of dorsal heart
  5. Triploblastic pseudocoelomate
Choose the correct answer from the options given below:
Options:
  • A, C and D only
  • B and C only
  • B, D and E only
  • C, D and E only
Answer: (b)
Question 189: Which of the following are NOT under the control of thyroid hormone?
  1. Maintenance of water and electrolyte balance
  2. Regulation of basal metabolic rate
  3. Normal rhythm of sleep-wake cycle
  4. Development of immune system
  5. Support the process of R.B.Cs formation
Choose the correct answer from the options given below:
Options:
  • A and D only
  • B and C only
  • C and D only
  • D and E only
Answer: (c)
Question 190: In cockroach, excretion is brought about by
  1. Phallic gland
  2. Urecose gland
  3. Nephrocytes
  4. Fat body
  5. Collaterial glands
Choose the correct answer from the options given below:
Options:
  • A and E only
  • A, B and E only
  • B, C and D only
  • B and D only
Answer: (c)
 
Question 191: The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :
Options:
  • Limbic system & hypothalamus
  • Corpora quadrigemina & hippocampus
  • Brain stem & epithalamus
  • Corpus callosum and thalamus
 
 
Answer: (a)
 
Question 192: Match List 1 and List 2.
List 1
List 2
A. Mast cells
I. Ciliated epithelium
B. Inner surface of bronchiole
II. Areolar connective issue
C. Blood
III. Cuboidal epithelium
D. Tubular parts of nephron
IV. Specialised connective tissue
Choose the correct answer from the options given below:
Options:
  • A-I, B-II, C-IV, D-III
  • A-II, B-III, C-I, D-IV
  • A-II, B-I, C-IV, D-III
  • A-III, B-IV, C-II, D-I
Answer: (c)
Question 193: Match List 1 and List 2.
List 1
List 2
A. Logistic growth
I. Unlimited resource availability condition
B. Exponential growth
II. Limited resource availability condition
C. Expanding age pyramid
III. The percent individuals of pre- reproductive age is largest followed by reproductive and post reproductive age groups
D. Stable age pyramid
IV. The percent individuals of pre- reproductives and reproductive age group
are same
Choose the correct answer from the options given below:
Options:
  • A-II, B-I, C-III, D-IV
  • A-II, B-III, C-I, D-IV
  • A-II, B-IV, C-I, D-III
  • A-II, B-IV, C-III, D-I
Answer: (a)
Question 194: Which of the following statements are correct?
  1. An excessive loss of body fluid from the body switches off
  2. ADH facilitates water reabsorption to prevent
  3. ANF causes vasodilation.
  4. ADH causes increase in blood
  5. ADH is responsible for decrease in
Choose the correct answer from the options given below:
Options:
  • A and B only
  • B, C and D only
  • A, B and E only
  • C, D and E only
Answer: (a)
 
Question 195: Given are two statements.
 
 
Statement 1: During G0 phase of cell cycle, the cell is metabolically inactive. Statement 2: The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
Options:
  • Both Statements 1 and 2 are correct
  • Both statements 1 and 2 are incorrect
  • Statement 1 is correct, but Statement 2 is incorrect
  • Statement 1 is incorrect, but Statement 2 is correct
Answer: (d)
 
Question 196: Select the correct statements.
  1. Tetrad formation is seen during
  2. During Anaphase, the centromeres split and chromatids
  3. Terminalization takes place during
  4. Nucleolus, Golgi complex and ER are reformed during
  5. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:
Options:
  • A and C only
  • B and D only
  • A, C and E only
  • B and E only
Answer: (b)
Question 197: Which one of the following is NOT an advantage of inbreeding?
Options:
  • It decreases
  • It exposes harmful recessive genes that are eliminated by selection.
  • Elimination of less desirable genes and accumulation of superior genes takes place due to (d) It decreases the productivity of inbred population, after continuous inbreeding, Answer: (a)
Question 198: Which of the following is characteristic feature of cockroach regarding sexual
dimorphism ?
Options:
  • Dark brown body colour and anal cerci
  • Presence of anal styles
  • Presence of sclerites
  • Presence of anal cerci
Answer: (b)
 
Question 199: Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3’?
Options:
  • 5’ UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3’
  • 3’ UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5’
  • 5’ ATCGATCGATCGATCGATCG ATCGATCG 3’
  • 3’ ATCGATCGATCGATCGATCG ATCGATCG 5’
 
 
Answer: (c)
 
Question 200: Which of the following statements are correct regarding skeletal muscle?
  1. Muscle bundles are held together by collagenous connective tissue layer called
  2. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
  3. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
  4. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below: Options:
  • A, B and C only
  • B and C only
  • A, C and D only
  • C and D only
Answer: (a)

Click Here to Download

Scroll to Top